Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:211-b4   

Cenix:211-b4RNAiCenix:211-b4
PCR_productcenix:211-b4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK05F1.7 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (5)
Overlaps_transcriptK05F1.7 Source_evidenceePCR384WS150 Sequence/Annotation Release
WB_DNA_textTH:211-b4739atattgggaaattgggccattcgacagaccatgtatttttaattataacaattaacaaacgatgaggtagaaaaatatttatttagaagttctaagggttatattcgattggcaggttcttacgacggaccataccatctccctggaaccactcgcggcggaactgcttggcagctccatccggggtgttggtccattcgacggtgatacggtcgttgttggtgtcttcctgtccaaatgcgaatgcatcacaggaaactgccagaagtacagcttcctttgggtccagcactccacatggtggatcaactccaagtctcttcatgttggtggtcttgataccgtacccaatacggcgagcagaagagttgatcactttaatgcgatacgtgtgcttgtcgtcgtacggagcattgaagacgatctttgtacccggttgggtctggatgtctcctggtggaacggattgggccatggcgacttcttgtaggagtttttggaaactcaatgaagaatttatgaattctttgagcttatatagggaggaattttataagtcacgtagatctttaacctaagttgtaacgcaaatttgtaattttgaataagaaaaaaaaatcataaacataacatattttttaaagtttcaactattaaaataaccaaaaatacaatgaagtataacttgcaacacttgtagagattcctaaaaggtaacttggccttctgtagagcacaa