Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:213-g3   

Cenix:213-g3RNAiCenix:213-g3
PCR_productcenix:213-g3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSVZK822L.1 Source_evidenceePCR150WS150 Sequence/Annotation Release
Overlaps_Gene VZK822L.1 Source_evidenceePCR150WS150 Sequence/Annotation Release
Chunk_score Abs_score129
Max_abs_score129VZK822L.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1191453111914680
Overlaps_transcriptVZK822L.1 Source_evidenceePCR150WS150 Sequence/Annotation Release
WB_DNA_textTH:213-g3150tggatcagcatcggtatcagtccacttgtgatggcaacgatgatcacgagcccattcgatgacgtcattttgaagagcaatattgttcaagatcatcaagaagattctcattggagttgttgctttgtatgatttgtgggaccagagacg