Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:214-e11   

Cenix:214-e11RNAiCenix:214-e11
PCR_productcenix:214-e11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y54E5A.4 Source_evidenceePCR145WS150 Sequence/Annotation Release
Chunk_score Abs_score124
Max_abs_score124Y54E5A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1470485114704995
Overlaps_transcript Y54E5A.4.1 Source_evidenceePCR145WS150 Sequence/Annotation Release
Y54E5A.4.2 Source_evidenceePCR145WS150 Sequence/Annotation Release
WB_DNA_textTH:214-e11145tccatccacgtgtcttatcgatttgttcttcgattgccacgttgtcaattgacatattctcggtttcttccataaattctcgatttttcttgaatttatcctcgatcaatgggagtaaatctctgattagagtggccgcttgtgt