Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:217-h11   

Cenix:217-h11RNAiCenix:217-h11
PCR_productcenix:217-h11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK792.3 Source_evidenceePCR123WS150 Sequence/Annotation Release
Overlaps_Gene ZK792.3 Source_evidenceePCR123WS150 Sequence/Annotation Release
Chunk_score Abs_score103
Max_abs_score103ZK792.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1167757311677699
Overlaps_transcriptZK792.3 Source_evidenceePCR123WS150 Sequence/Annotation Release
WB_DNA_textTH:217-h11127attcccacgtgtcaccttctgtgactttgaaatccgtgagactgccggaaacaatcgtgcggaaactgttgaatgtctgattggaatcaatgtatttaatgagaaaatcttccttttcctctggcaa