Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:219-f10   

Cenix:219-f10RNAiCenix:219-f10
PCR_productcenix:219-f10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08G2.6 Source_evidenceePCR96WS150 Sequence/Annotation Release
Overlaps_Gene F08G2.6 Source_evidenceePCR96WS150 Sequence/Annotation Release
Chunk_score Abs_score75
Max_abs_score75F08G2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1383543213835527
Overlaps_transcriptF08G2.6 Source_evidenceePCR96WS150 Sequence/Annotation Release
WB_DNA_textTH:219-f1096aacaagatgggatccacaggaacgatagggaaggaaggccgcatttgggaccgggtgaattggattggcattggtgagcacggtgagcatagcaat