Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:219-h1   

Cenix:219-h1RNAiCenix:219-h1
PCR_productcenix:219-h1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC29F9.8 Source_evidenceePCR120WS150 Sequence/Annotation Release
Overlaps_Gene C29F9.8 Source_evidenceePCR120WS150 Sequence/Annotation Release
Chunk_score Abs_score99
Max_abs_score99C29F9.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII9691397037
Overlaps_transcriptC29F9.8 Source_evidenceePCR120WS150 Sequence/Annotation Release
WB_DNA_textTH:219-h1125ctaaccttcctggccacctcttcaccacaaaacatcctccccacagttttccggtacaaagtgttcactccaaggcagagaaggcagtggagaatcgcgttaattggcacgaaaatcgtgaaaat