Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:22-g4   

Cenix:22-g4RNAiCenix:22-g4
PCR_productcenix:22-g4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC10H11.9 Source_evidenceePCR510WS150 Sequence/Annotation Release
Overlaps_Gene C10H11.9 Source_evidenceePCR510WS150 Sequence/Annotation Release
Chunk_score Abs_score468
Max_abs_score468C10H11.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI47424144742971
Overlaps_transcriptC10H11.9 Source_evidenceePCR510WS150 Sequence/Annotation Release
WB_DNA_textTH:22-g4558ttccgttaaatgtcttcggcaattgaaagtctcccgcattatctcgatcacgggtctcgatttcttcgaaatgtgtcgtgtcatcgtccgattttaatgaaggaatgaccggtggagatgctgaaaagttttaatttaattattttcattcgaaaatattgaacaaaccttctctgagagtggcaaatgtccattcgtcattaacaaaaaacttgtgatttcgaatatcatcgacgctatttcttccaagacgatctggagccgccgagaggaatttcttgataatatccttggcttgggtagaaattaatggctcatcaggaaatttcagacttgttttatgattcataatatttgtataagttgatacaagtgcctcggcatagaatggtgtttctccaacaagcatttcatatatgaacacaccaacagaccaccaatcgacttcttttccaaattcagcatcttgtccttgatttctcaaaacttccggtgatatgtaatcaggagttccgactgctgtggagcatcgcacaactccattggcattcatcttca