Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:220-c2   

Cenix:220-c2RNAiCenix:220-c2
PCR_productcenix:220-c2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F18A1.2 Source_evidenceePCR102WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII76839647684065
Overlaps_transcript F18A1.2.2 Source_evidenceePCR102WS150 Sequence/Annotation Release
F18A1.2.1 Source_evidenceePCR102WS150 Sequence/Annotation Release
F18A1.2.3 Source_evidenceePCR102WS150 Sequence/Annotation Release
WB_DNA_textTH:220-c2102tggcaaccagaggaggttactgtaaagaaagaagaagtagaggagtctccaactcttgtcaaacaagaactcactcttgttaaacaagaacccacttttgcc