Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:223-e12   

Cenix:223-e12RNAiCenix:223-e12
PCR_productcenix:223-e12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F44F4.11 Source_evidenceePCR116WS150 Sequence/Annotation Release
Y19D2B.1 Source_evidenceePCR116WS150 Sequence/Annotation Release
Overlaps_Gene F44F4.11 Source_evidenceePCR116WS150 Sequence/Annotation Release
Chunk_score Abs_score95
Max_abs_score95F44F4.11
Specificity_index0.559
Rel_score1
Map_statusBest_ePCRII1091993510920058
Y19D2B.1 Source_evidenceePCR116WS150 Sequence/Annotation Release
Chunk_score Abs_score75
Specificity_index0.441
Rel_score0.789
Map_statusBest_ePCRII1092260210922725
Overlaps_transcript F44F4.11 Source_evidenceePCR116WS150 Sequence/Annotation Release
Y19D2B.1 Source_evidenceePCR116WS150 Sequence/Annotation Release
WB_DNA_textTH:223-e12124cttcttccaatccctcgttggaatcagctccgacctcttcgtagtccttctcgagagctgccaagtcttcacgagcctcagtgaactctccctcttccattccttctccgacgtacctgcaaat