Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:225-e3   

Cenix:225-e3RNAiCenix:225-e3
PCR_productcenix:225-e3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y66D12A.22 Source_evidenceePCR93WS150 Sequence/Annotation Release
Chunk_score Abs_score72
Max_abs_score72Y66D12A.22
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1150090611500998
Overlaps_transcript Y66D12A.22.1 Source_evidenceePCR93WS150 Sequence/Annotation Release
Y66D12A.22.2 Source_evidenceePCR93WS150 Sequence/Annotation Release
WB_DNA_textTH:225-e393gagcagcttcatctccttgcgacatgcttgtcaaccgttttccgagcttctcgtgaacatccagatactttgcaacacaacgatccaagcaga