Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:230-g11   

Cenix:230-g11RNAiCenix:230-g11
PCR_productcenix:230-g11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22B8.4 Source_evidenceePCR129WS150 Sequence/Annotation Release
Overlaps_Gene F22B8.4 Source_evidenceePCR129WS150 Sequence/Annotation Release
Chunk_score Abs_score108
Max_abs_score108F22B8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1609067416090834
Overlaps_transcriptF22B8.4 Source_evidenceePCR129WS150 Sequence/Annotation Release
WB_DNA_textTH:230-g11161tggaattcttatgcaggatgcttccggtacgatcagtcatcaatcaatattttgctgttcaatcagtttcgagatcacaacagttactttatggcaaagaatgttggtgtagttaatcggacgtattaggaaattagaaatttagatagccgggggttttc