Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:233-e2   

Cenix:233-e2RNAiCenix:233-e2
PCR_productcenix:233-e2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y71H2AM.4 Source_evidenceePCR175WS150 Sequence/Annotation Release
Chunk_score Abs_score154
Max_abs_score154Y71H2AM.4
Specificity_index0.5
Rel_score1
Map_statusBest_ePCRIII27864912786665
Y71H2AM.5 Source_evidenceePCR175WS150 Sequence/Annotation Release
Chunk_score Abs_score154
Max_abs_score154Y71H2AM.5
Specificity_index0.5
Map_statusBest_ePCRIII27864912786665
Overlaps_transcript Y71H2AM.4.1 Source_evidenceePCR175WS150 Sequence/Annotation Release
Y71H2AM.5.2 Source_evidenceePCR175WS150 Sequence/Annotation Release
Y71H2AM.5.3 Source_evidenceePCR175WS150 Sequence/Annotation Release
Y71H2AM.5.1 Source_evidenceePCR175WS150 Sequence/Annotation Release
WB_DNA_textTH:233-e2175aacgtcaatgcttcgcctactacgtcgatttccatcgttgcaatgagctcatgggacaggactacaagccgtgcaagttcttccaaaatgtctacaaggacttctgccccggattctggaccgagagatgggacgagcttctttccgagggacgtttcccagctaaattcgatcg