Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:234-b5   

Cenix:234-b5RNAiCenix:234-b5
PCR_productcenix:234-b5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC29E4.9 Source_evidenceePCR122WS150 Sequence/Annotation Release
Overlaps_Gene C29E4.11 Source_evidenceePCR122WS150 Sequence/Annotation Release
Chunk_score Abs_score122
Max_abs_score122C29E4.11
Specificity_index0.5
Rel_score1
Map_statusBest_ePCRIII79564127956543
C29E4.9 Source_evidenceePCR122WS150 Sequence/Annotation Release
Chunk_score Abs_score122
Max_abs_score122C29E4.9
Specificity_index0.5
Map_statusBest_ePCRIII79564127956543
Overlaps_transcript C29E4.11 Source_evidenceePCR122WS150 Sequence/Annotation Release
C29E4.9 Source_evidenceePCR122WS150 Sequence/Annotation Release
WB_DNA_textTH:234-b5132taaaacaaaccagttggccggatcaacacctctcagaaaataagcagttccaggagtttgagtagaagttggagtgaacgaagagccggaaagtgttgaaacatcacaagatggacaatttcgaagtgcagg