Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:235-b1   

Cenix:235-b1RNAiCenix:235-b1
PCR_productcenix:235-b1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55G1.2 Source_evidenceePCR103WS150 Sequence/Annotation Release
Overlaps_Gene F55G1.2 Source_evidenceePCR103WS150 Sequence/Annotation Release
Chunk_score Abs_score82
Max_abs_score82F55G1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV74883327488434
Overlaps_transcriptF55G1.2 Source_evidenceePCR103WS150 Sequence/Annotation Release
WB_DNA_textTH:235-b1103ggaggagtcaagaagccacatcgttatcgtccaggaaccgtcgctctccgtgagatcagacgttaccaaaaatccaccgaacttcttatccgcagagctccat