Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:236-c7   

Cenix:236-c7RNAiCenix:236-c7
PCR_productcenix:236-c7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF09C12.7 Source_evidenceePCR99WS150 Sequence/Annotation Release
Overlaps_Gene F09C12.7 Source_evidenceePCR99WS150 Sequence/Annotation Release
Map_statusUnique_ePCRII51152025115300
Overlaps_transcriptF09C12.7 Source_evidenceePCR99WS150 Sequence/Annotation Release
WB_DNA_textTH:236-c799acggtcgttgtttgtgtcttcttgtccgaaggcgaaggcatcgcaggaaacggccagaagaacagcttcctttgggtcgaggactccacatggtggatc