Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:236-e3   

Cenix:236-e3RNAiCenix:236-e3
PCR_productcenix:236-e3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY75B8A.30 Source_evidenceePCR148WS150 Sequence/Annotation Release
Overlaps_Gene Y75B8A.30 Source_evidenceePCR148WS150 Sequence/Annotation Release
Chunk_score Abs_score127
Max_abs_score127Y75B8A.30
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1235046512350612
Overlaps_transcriptY75B8A.30 Source_evidenceePCR148WS150 Sequence/Annotation Release
WB_DNA_textTH:236-e3148ccttcccatcaattacagcggcaagtgataagtagtcgaaaacttcggtacaatgtttccaaacagacgcatttccatatttccgaaggcattcatcatagaacccgtagacttgagtaatctggcgactttcgtgatttccacggat