Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:238-e9   

Cenix:238-e9RNAiCenix:238-e9
PCR_productcenix:238-e9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y62E10A.12 Source_evidenceePCR140WS150 Sequence/Annotation Release
Chunk_score Abs_score119
Max_abs_score119Y62E10A.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1338886713389006
Overlaps_transcript (2)
WB_DNA_textTH:238-e9140gaagagacaatcaccacccgtgaagtcgacgaagacacattcgaagagatctacaaacaaacaaaacgtgttgttccaatgcttttcgttcgtggtgattctgtcattctcgtgtctccaccgattcgtgcatcctaatt