Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:238-g9   

Cenix:238-g9RNAiCenix:238-g9
PCR_productcenix:238-g9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY40H7A.7 Source_evidenceePCR121WS150 Sequence/Annotation Release
Overlaps_Gene Y40H7A.7 Source_evidenceePCR121WS150 Sequence/Annotation Release
Chunk_score Abs_score100
Max_abs_score100Y40H7A.7
Specificity_index0.585
Rel_score1
Map_statusUnique_ePCRIV1519827515198395
Y71A12B.14 Chunk_score Abs_score71
Specificity_index0.415
Rel_score0.71
Overlaps_transcriptY40H7A.7 Source_evidenceePCR121WS150 Sequence/Annotation Release
WB_DNA_textTH:238-g9121gccagccaccaagaaaatctagatctagaagaagagaaagatgaagacgatgaatacgaggaagccggtgaaacaagcaacacctaccaatcgggaatttcggatgacgacgatgaagacc