Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:239-a4   

Cenix:239-a4RNAiCenix:239-a4
PCR_productcenix:239-a4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF45F2.3 Source_evidenceePCR78WS150 Sequence/Annotation Release
Overlaps_Gene F45F2.3 Source_evidenceePCR135WS150 Sequence/Annotation Release
Chunk_score Abs_score93
Max_abs_score93F45F2.3
Specificity_index0.596
Rel_score1
Map_statusUnique_ePCRV85380368538179
F22B3.1 Chunk_score Abs_score63
Specificity_index0.404
Rel_score0.677
Overlaps_transcriptF45F2.3 Source_evidenceePCR135WS150 Sequence/Annotation Release
WB_DNA_textTH:239-a4144agaaagactgtcaccgccatggacgtcgtctatgctttgaagcgtcaaggaagaactctgtacggattcggaggataattttatctctcgatttcatacaacaaaccaaccgaacccaacggccctctttagggccacaaatgc