Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:24-a1   

Cenix:24-a1RNAiCenix:24-a1
PCR_productcenix:24-a1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25B4.6 Source_evidenceePCR513WS150 Sequence/Annotation Release
Overlaps_Gene F25B4.6 Source_evidenceePCR513WS150 Sequence/Annotation Release
Chunk_score Abs_score450
Max_abs_score450F25B4.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV56862415686845
Overlaps_transcriptF25B4.6 Source_evidenceePCR513WS150 Sequence/Annotation Release
WB_DNA_textTH:24-a1605gtcaaatgagttcagcccgtcgatacccgttgtatggcgattaacttttgatatgaaatatgtgtatgtcattctgactgcttccaaatatgagctcaatgataatgatccatcgacaacggggtattcactcggaatcggcgctggaatttaattttttaaaagtaaatagagaaattaatagcttactaattggcttaaagaaatcccacgtgtttttcatgtgacacgctgaaaactgccgatcaatcggaatagaagcatctggacaaataagaaaagcaatcgctcctgcaccgcctgtacatctcgctggaccttcttcatatattgcaatatccgcgactactacaattgcgtttttcttatcaagcggatgattcactgtgacccaatcgatagcgtgcagcagtgcctgaaaatataattgaagattctattttgagagacaaaaaactcacttgtgcgcctccaaagcaggcatttttgatgtcgactccttcaatatccgaatttccaggaaataagtccattaaagctgtcttcacacttttgctcttgtcgatcattgtttcggtacctacaaccaaacagccaatcgaatc