Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:24-e3   

Cenix:24-e3RNAiCenix:24-e3
PCR_productcenix:24-e3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32B6.9 Source_evidenceePCR511WS150 Sequence/Annotation Release
Overlaps_Gene F32B6.9 Source_evidenceePCR511WS150 Sequence/Annotation Release
Chunk_score Abs_score427
Max_abs_score427F32B6.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV99048499905507
Overlaps_transcriptF32B6.9 Source_evidenceePCR511WS150 Sequence/Annotation Release
WB_DNA_textTH:24-e3659tcgttggatcacaccacttcattggattcaactaattatgcgacaagttgaagaggtacgttatcataggcaatgggttactgtagttactcattttgctttcatttcaggaacacaaaccaacggcttcccttttcaaccagtttgttggtgaacttcgaattttccgtcaatctcttcgtaagctgtattcatatgattgggtgtgtgttcctcttgtttatacacaagtcgctgctttggcaacctactctttcttctttttcacacttttcggccgtcaaccacttttcccagatattgaaactggaaaagagcttgatctagttgtaccagtgtttacaatagttcaattcttattcttcgttggatggtttaaggtaggtgttataatacgttttctgtagaacaaatgttgaaaaataggtcggacaagatttgatgcgaccctttggattagatgatgatgacatcgaactgaactacattttggataggaatgttcgaatttcttttgctattgtaaatcaactccaggaatcaccaattcgtaagttttaagtaatcatttgctaaaatcaaaataattatttatagcggatttcgaaagtaacgacgataaactttggcacgaaatgcatccaccaaccaaagatgga