Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:24-f5   

Cenix:24-f5RNAiCenix:24-f5
PCR_productcenix:24-f5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF36G9.13 Source_evidenceePCR621WS150 Sequence/Annotation Release
Overlaps_Gene F36G9.13 Source_evidenceePCR621WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1598656715987187
Overlaps_transcriptF36G9.13 Source_evidenceePCR621WS150 Sequence/Annotation Release
WB_DNA_textTH:24-f5621ccagtcattgcggaattcttcaacgttgacacagcaattcttcaacaactagagaagttcaacaaggcttctgtagataagtttgttgaaagcttaaacagcgcggcaattgactcaaacgaggatacattgaaagttgagcaggcgatgattaatattcatgaagtaaagatggcatggaaaaagattggaagcttaagcaacatacctgcaaagagtacattagatcctctttcaactatcgcatcttgggatttatctgtattgaaatcatttgatttgatcagcacattgcatttgatcgattcagagagtccatccgttttagatttgaaaaaaaagctggaaacattaacttccgctgtcaagaaacttcccactccaaaaaaaatgaaacctttcattgatttacttaaaaaatggacacctttcgatcagtttgcggatatcgttgggctgcatctaggctactcaagcatcttaagttatcctcttactaactccaagtttgacagtaacgcaaacgctgttaacaacatcactgcagtagaaaaaagcagcattattctgatgaaggatgtcgcagttgcaccgttttcgcctgccaatcgtagcttcaca