Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:24-f8   

Cenix:24-f8RNAiCenix:24-f8
PCR_productcenix:24-f8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF44F4.11 Source_evidenceePCR538WS150 Sequence/Annotation Release
Overlaps_Gene (4)
Overlaps_transcriptF44F4.11 Source_evidenceePCR538WS150 Sequence/Annotation Release
WB_DNA_textTH:24-f8583caatcaccgcttcactcagatttgacggagctctcaacgtggatctcaacgagttccagaccaacttggtgccatacccaagaattcatttcccattggcctcttacactccattgatctctgccgagaaggcatatcacgaggctctgtctgtcaatgacatcaccaatagctgcttcgaaccagcaaatcagatggtcaaatgtgatccacgcaacggaaagtacatggctgtctgtcttctgtaccgcggagatgttgtgccgaaggatgtgaacactgcaattactgccatcaaaaccaagagatcagttcaatttgtggattggtgcccaactgggttcaaggttggaatcaactaccaaccaccaactgtggttccaggaggtgatcttgccaaggtgccacgcgccgtgtgcatgctctccaacactacggctatcgccgaggcctggtcccgcctggactacaagtttgacttgatgtacgccaagcgcgcctttgttcactggtaagattcgagttgtttgaaacacaaaatatcgattatttgcaggtacgtcggagaaggaatggaagaggg