Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-d2   

Cenix:242-d2RNAiCenix:242-d2
PCR_productcenix:242-d2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC04G2.4 Source_evidenceePCR372WS150 Sequence/Annotation Release
Overlaps_Gene (28)
Overlaps_transcriptC04G2.4 Source_evidenceePCR390WS150 Sequence/Annotation Release
WB_DNA_textTH:242-d2390ctccttcatcgaacgaccatggcccaatccgtcccaccaggagacatccaaacccaaccaaacgcgaagatcgtctttaatgctccatacgatgacaagcacacctatcacatcaaggtgatcaactcatcggctcgtcgtattggatatggtatcaagaccaccaatatgaagagacttggagttgatccaccatgtggagttctcgatccaaaggaagctgtgcttcttgctgtttcctgcgatgctttcgccttcggacaagaggataccaacaacgaccgtatcactgttgagtggaccaacaccccggatggagctgccaagcaattccgtcgtgaatggttccagggagacggtatggttcgtcgcaagaaccttccaatcgag