Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-e1   

Cenix:242-e1RNAiCenix:242-e1
PCR_productcenix:242-e1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0035.9 Source_evidenceePCR224WS150 Sequence/Annotation Release
Overlaps_Gene (5)
Overlaps_transcriptB0035.9 Source_evidenceePCR224WS150 Sequence/Annotation Release
WB_DNA_textTH:242-e1442tcgcagtaggtgacagcatcacggatgacgttctcaaggaacaccttcaagactccacgggtttcctcgtagatcaatccggagattctcttgactcctcctcttctggcgagacggcgaatggctggcttggtgataccttggatgttatcacggagaactttgcgatggcgcttggcaccaccttttccaaggccttttcctccctttccacgtccggacattgttgaattcgttgaagactcacaagtgagatgaagaaatgacatcacagtattccttttgtacacagctgtggtggctaggcggagtcacattgcaccactctgcgaggacacctttcctttgtctgtaacacaccgaatgttctaattgccacaaggacagaagtgcgcccgcccgccctcccaccgcagctgcgtacaaaggcagtcgttggttt