Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-e5   

Cenix:242-e5RNAiCenix:242-e5
PCR_productcenix:242-e5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06C4.10 Source_evidenceePCR235WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcriptK06C4.10 Source_evidenceePCR235WS150 Sequence/Annotation Release
WB_DNA_textTH:242-e5398gaggcggggaagttagagagtaggtaagagtgagtgagaacaaagataacaagacaaatgtgtccccgcagtgtctcctccttcacaccgcatagtggtataaaagggacagccaactgtccatttcttcatctcacttgtgagtcttcattcaactgcaacaatgtccggacgtggaaagggaggaaaaggcctcggaaaaggaggtgccaagcgccatcgcaaggtccttcgtgacaacatccaaggaatcaccaagccagctattcgccgtctcgctcgtcgtggtggagtcaagcgtatttctggactcatctacgaggaaactcgtggagttctcaaggtgttcctcgagaacgtcatccgtgatgccgtcacctactgtgagcacgccaaga