Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-e7   

Cenix:242-e7RNAiCenix:242-e7
PCR_productcenix:242-e7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10C6.12 Source_evidenceePCR283WS150 Sequence/Annotation Release
Overlaps_Gene (9)
Overlaps_transcriptT10C6.12 Source_evidenceePCR297WS150 Sequence/Annotation Release
WB_DNA_textTH:242-e7434cgcagagtgcacagtttttctcggtcactctgccacctcctccacctgccttgtgtctatgtgcccgcctagtcaccgcagttgtgtttaaaagagtgtggtctaatggtctccttcagatcgtttttacatctaccaaccaatcatcaccatgtctggacgcggaaagggaggcaaagccaagaccggaggaaaggccaagtcccgctcatcaagagccggactccaattcccagttggtcgtcttcaccgtattctccgtaaaggaaactacgctcaacgtgttggagccggagccccagtttacctggctgccgttcttgagtacctcgctgctgaggttctcgagttggctggaaacgctgcccgtgataacaagaagaccagaattgccccaagacatctccaactggccgtccgtaacgatgaggagt