Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-h2   

Cenix:242-h2RNAiCenix:242-h2
PCR_productcenix:242-h2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF36H12.7 Source_evidenceePCR350WS150 Sequence/Annotation Release
Overlaps_Gene (33)
Overlaps_transcriptF36H12.7 Source_evidenceePCR359WS150 Sequence/Annotation Release
WB_DNA_textTH:242-h2359cccagccgggtactaagattgtgttcaatgccccatacgacgacaaacacacctaccacatcaaggtgatcaactcatctgctcgccgtattggatacggtatcaagaccaccaatatgaagagacttggagttgatccaccatgtggagttctcgacccaaaggaagcagttcttcttgccgtttcctgtgatgctttcgcctttggacaagaagacaccaacaacgatcgtatcactgttgagtggaccaacaccccggatggagctgccaagcaattccgccgtgaatggttccaaggagacggtatggttcgtcgtaagaacctcccaatcgagtacaacccatagagccctgtg