Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:243-c6   

Cenix:243-c6RNAiCenix:243-c6
PCR_productcenix:243-c6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC09B9.6 Source_evidenceePCR170WS150 Sequence/Annotation Release
Overlaps_Gene (10)
Overlaps_transcriptC09B9.6 Source_evidenceePCR199WS150 Sequence/Annotation Release
WB_DNA_textTH:243-c6306ttatcccgatctgaagccactgtgcactcttacagttgtactcaaatttgatacgtttttaaatctgaaatttttaaacaagagaaaaaacaacgatctttcaaaattcatttattgaataagaaagcacagggctctatgggttgtactcgattggaaggttcttacgacgaaccataccgtctccttggaaccattcacggcggaattgcttggcagctccatccggggtgttggtccactcaacagtgatacggtcgttgttggtgtcttcttgtccaaaggcaaaagcatcacaggaaacgg