Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:245-g8   

Cenix:245-g8RNAiCenix:245-g8
PCR_productcenix:245-g8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY73B6BL.38 Source_evidenceePCR345WS150 Sequence/Annotation Release
Overlaps_Gene Y73B6BL.38 Source_evidenceePCR345WS150 Sequence/Annotation Release
Chunk_score Abs_score282
Max_abs_score282Y73B6BL.38
Specificity_index0.766
Rel_score1
Map_statusUnique_ePCRIV64223756422719
Y45F10A.2 Chunk_score Abs_score86
Specificity_index0.234
Rel_score0.305
Overlaps_transcriptY73B6BL.38 Source_evidenceePCR345WS150 Sequence/Annotation Release
WB_DNA_textTH:245-g8345ttcttacggagcacttggctagtgatttgtacaatctctgccttgacaagagtgcgtgccgagtcattcaactggctatccagaagcttgacgttcatcttgcaactcgtttgtccttggagctccgtgacacgtacctcgtccgtctcagcatcgatcaaaacggaaaccacgtgattcagaaaatcgtcaagacgcttccagtctctgcgtggagtttcgtcgtggagttcttcgccgacgacgacaatctcattcacgtgtgccaagacaaatatgggtgccgtgtcattcaatcgaccgttgaaactctgtcttctgatacatacgcggaatgctaccaac