Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:246-b8   

Cenix:246-b8RNAiCenix:246-b8
PCR_productcenix:246-b8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26G1.7 Source_evidenceePCR343WS150 Sequence/Annotation Release
Overlaps_Gene (26)
Overlaps_transcriptF26G1.7 Source_evidenceePCR361WS150 Sequence/Annotation Release
WB_DNA_textTH:246-b8361taccgtctccttggaaccactctcggcggaactgcctggcagctccatccggggtgttggtccactcaacagtgatacgatcgttgttagtgtcctcctgtccgaaggcgaaggcatcgcatgacacggcaagaagcacagcttcctttgggtccaaaactccacatggtggatcaactccaagtctcttcatattggtggtcttgattccatatccaatacggcgagcagatgaattgatcaccttaatgtggtaggtgtgcttgtcgtcgtatggtgcattgaagacgatcttcgtacccggctgggtttggatgtctcctggtgggacggattgggccatggcgacttgttggaagag