Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:25-a3   

Cenix:25-a3RNAiCenix:25-a3
PCR_productcenix:25-a3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS K08A8.1a Source_evidenceePCR527WS150 Sequence/Annotation Release
K08A8.1b Source_evidenceePCR527WS150 Sequence/Annotation Release
Overlaps_Gene K08A8.1 Source_evidenceePCR527WS150 Sequence/Annotation Release
Chunk_score Abs_score464
Max_abs_score464K08A8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX74794607480091
Overlaps_transcript K08A8.1b Source_evidenceePCR527WS150 Sequence/Annotation Release
K08A8.1a Source_evidenceePCR527WS150 Sequence/Annotation Release
WB_DNA_textTH:25-a3632ggagcttcagttcgtggaagatattggtcatggaagctgcggtacggtcacaaagtgcagatacaagagtgtgatcatggctgtgaagacgatgcctcggacgtcaaacagttatgaaatgtcccgcattttgatggatcttgacgtcatctgtctctctttcgactgtccgtacattgtacgttgcttcggatacttcatcaccaacgtaagaatttttatgaattctttgacttttccaattatcatttttttcagttcgacgtccgtgtctgcatggagtgcatggctacttgccttgaccgtctgcttatccgcatcaagcagccaattccagagagaattattggaaagttgagtgtgagcatcattaaagctctgcactacttgaaaaccaagcacgtaagtttataaatcagatgaaccatttggacaatatataatccgatttttttagcaaatcatgcaccgtgatgtgaagccatcaaacattctcctcgactggagtggcgtcatcaagctttgcgatttcggtattgctggcagactgatcgagtctcgtgctcattcgaagcaagccggatgccctctgtacatgggtcctgagcgcctcgaccccaacaactttgact