Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:25-b7   

Cenix:25-b7RNAiCenix:25-b7
PCR_productcenix:25-b7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR06C7.5a Source_evidenceePCR519WS150 Sequence/Annotation Release
Overlaps_Gene R06C7.5 Source_evidenceePCR519WS150 Sequence/Annotation Release
Chunk_score Abs_score498
Max_abs_score498R06C7.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI72478327248350
Overlaps_transcript (3)
WB_DNA_textTH:25-b7519atccttctcgaatggctcaagaagttctccaaatgcctgaagaacacgaatatccgtgcaaactttcttagcagcagctccgagaagagagagggagaatacaagctgagagtcttgctgtcttgagtaggtttgcccagttatcaaaaatcggttagaaaaattggcttttttggtgaccaattcatcgagagcttcaactttgctctcgtctccagcgaatagagtaaggaacgagtcttgtgttccagtagcacccttgattccacggaatctcattttgtctcgaaactctgacaatgattggaaggccatgagaagctcttgagcccaaagtacaccacgttttcctacagtaacaagggaggctgtctggtaatgagtacgtccgacagtcacaacttccttgttcttcaatgaaaaagcggcgagacgatcaatgacagttgcgaaccgtttaagaatatgatcaatcgaatctcgataggcaataagatcagcattgtcttgaacgaagca