Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:25-f7   

Cenix:25-f7RNAiCenix:25-f7
PCR_productcenix:25-f7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS R07G3.3a Source_evidenceePCR535WS150 Sequence/Annotation Release
R07G3.3b Source_evidenceePCR535WS150 Sequence/Annotation Release
Overlaps_Gene R07G3.3 Source_evidenceePCR535WS150 Sequence/Annotation Release
Chunk_score Abs_score493
Max_abs_score493R07G3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII76012367601818
Overlaps_transcript R07G3.3a Source_evidenceePCR535WS150 Sequence/Annotation Release
R07G3.3b Source_evidenceePCR535WS150 Sequence/Annotation Release
WB_DNA_textTH:25-f7583tgaacgtcaaagcagaatgcaagatccaaactggagtgaacaagctgatgagcaacttttccaaaacatcgtccaactacaacgacgaaacgtagagctcgagtcagacattgagaatgctaaagcaagtgctgcacaagctgctataaacgcccaaagtgaagaaatggcacaacttcgtgccgatcttgctgtaaccaagaaatcggaagctgagttgaaaactaaggtggagcaaacaaaggctgcattcgacagtgtaagatatataatttgtaaagttatcaaatttaattgacggtttcagttgaaagaacgaactgagcatttcaaggaattggtcagagacagtgtcactgcagctgaagcgagaacagctcgcttgagagcggaagaagctattgctgcgaaggttgttgctgatgctactatcgagcgtttgaggacccaggcggaagattacaaggcagatcacctccgtcgagagcaagaccttgagcagagaatcaggaatacagaggcaaacattgctagtgttacagaaactaacattaagctgaatgcgatgcttgatgctcagaaa