Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:26-c6   

Cenix:26-c6RNAiCenix:26-c6
PCR_productcenix:26-c6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW03F11.2 Source_evidenceePCR549WS150 Sequence/Annotation Release
Overlaps_Gene W03F11.2 Source_evidenceePCR549WS150 Sequence/Annotation Release
Chunk_score Abs_score487
Max_abs_score487W03F11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI22282602228881
Overlaps_transcriptW03F11.2 Source_evidenceePCR549WS150 Sequence/Annotation Release
WB_DNA_textTH:26-c6622aaccccaaaaatccaccttcttagatataggcttaagatgtgatgcctcaacatgccatagctcatcttgtcgctcgatttcctttcttttttgtctgaaaattaaccctttttacttctatttttctcctaaaacttaccgaatcgcgtagaaaaccgctccaactgcggcggaaaccgcaaaaatcaggaacatcacaatgataatgactatcaccaaataatctctgacaaagtccggtgggcattgagttccagtaaacccacaagtcggcttcgccttgggacgttgtctcccgttccagacatccattacctcatcggagtagagttgctcgaaatgtacggattgattattaattattagttttccgtaggtttccggaagtcgagatgagttcaatccgatcattatgatctctgaggtacgcgccgaatctggatctacggttagatcgcctccaccgacaccttcgaatgtcattccgatgtttcgaaggatcattgttccatttcgaatttcagcttggggatttgcagttagcaatctatttactgcaactgcgtaggcgtaaaaggcatccgcaagttggccagcgtattttgcgacctggaagaattc