Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:26-c8   

Cenix:26-c8RNAiCenix:26-c8
PCR_productcenix:26-c8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC196.7 Source_evidenceePCR504WS150 Sequence/Annotation Release
Overlaps_Gene ZC196.7 Source_evidenceePCR504WS150 Sequence/Annotation Release
Chunk_score Abs_score483
Max_abs_score483ZC196.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV87201188720629
Overlaps_transcriptZC196.7 Source_evidenceePCR504WS150 Sequence/Annotation Release
WB_DNA_textTH:26-c8512tgattaaggaattcgtcgcctggaacaactcttggaaagtgaagagtacgcttccattcgtttttatttaataaaagtgcacgacggagattatatgaaagcagctcgtcaagttaaagaactcgaagaatgtcgtctcctccataaaaaagattgctccgagttcagtcgcctccttgttgatatgaatccagaacatacttacacctttttgcttgcatctcttcaaatgggactcattgagttgaagcactggtttctgctcaccaatatggagctttccacaatggacatggaacttttccgctataatcatgctcgtttcatctcgccatatccagtcgattccacttttctgactgagaatcgcgacgcgttcaatttttctcactttaaggaacatatcacagagaaatgggcaatgaaaaccgacaacagccggaacttgaagatgatggaagctgtcttcacttttgacgctgtttatgcatttgccaatgtgttcaacgagt