Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:27-h12   

Cenix:27-h12RNAiCenix:27-h12
PCR_productcenix:27-h12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene W02F12.5 Source_evidenceePCR687WS150 Sequence/Annotation Release
Chunk_score Abs_score645
Max_abs_score645W02F12.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV67101706710906
Overlaps_transcript W02F12.5.2 Source_evidenceePCR687WS150 Sequence/Annotation Release
W02F12.5.1 Source_evidenceePCR687WS150 Sequence/Annotation Release
W02F12.5.3 Source_evidenceePCR687WS150 Sequence/Annotation Release
WB_DNA_textTH:27-h12737ttccgttgactggaacaacacgatcaaacactccgtgcattcccaaaattgcactttgtggtggattgatgattggggttccgaacatggatccgaagactccaccgttagaaatcgtgaaggttcctccctccatatcttcaacagccagctttccgtcacgagccttcactccgagattggcaagttccaattcgatttgagcataattcatgctctcgacatttctcaagactggaacaacgagtcctttcggtgtagcaacagcaacggagatatcgacaaagtgacggtagacaatttcgttttcatcgagaacggcgttaacaactggagattcttgaagagcgtaggcggcagcgcggacaaatggagacatcattccgagcttaactccgtgcttggcaacaaaatccttctgataagtctttctcatttcgatgaggctgctgcaaaaacacgaaaactttttttaaaaacccagaaaacaacaaaaaacctcatatcaatctcattgaaggtagtaagcatagcataagtattctgagcatccttcagtctttgagcaatgcgcatgcgcattctgttggctttaacgcggacttcatcacgggctccggtgattgcgtgggatggatcaactccctttggaacaacgacacgagtgactgggacggctccgactggagtggaagatgatggtgttgatggtgggcgagcaactggtggagcagatt