Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:28-d1   

Cenix:28-d1RNAiCenix:28-d1
PCR_productcenix:28-d1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y70C5C.6a Source_evidenceePCR508WS150 Sequence/Annotation Release
Y70C5C.6b Source_evidenceePCR508WS150 Sequence/Annotation Release
Overlaps_Gene Y70C5C.6 Source_evidenceePCR508WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1672528516726014
Overlaps_transcript Y70C5C.6a Source_evidenceePCR508WS150 Sequence/Annotation Release
Y70C5C.6b Source_evidenceePCR508WS150 Sequence/Annotation Release
WB_DNA_textTH:28-d1730aaaatccgttggctaatcccaaagttgtttttacacctctagcgattttcagaacgttccgatcattttcagaaccttcataactttccgattttttccttaccattatcaaagaacgccagccaaacgatagccatatattcaagctcttcgagccccattgacgaaatcggaagaatcatttttgtgtagtagtaatcccagtatggccggaagttactggaaacttttcgcatttaatggccgacattttttgaaggtttacctaacaatttcagatttagacatttccttcccttctggaaatgttccaccataaaacccaaccagcaaattttcataatcctcttcctccagattatcgaacttttcagcacactcccggtactcgaggattggctcaatctgccataattttggcacaaagttccgtaacagagcttgctggaattccagtttttagagcgaagaacttcaaagtcaaacctactctatccctgtcctcaagtacttctacagttgggaaggccttgctaaccatccgccacgtcaattcaagatctcttagcacaaaactagtgagttcgaaaatattgcaattattgagagatccactgttcatttcttctctagtcattttcaactcgtgccagtttgatagaacacaatataagtttggtgtttggcgggaagttatcggagtctaaaaataagtacattcttcgggccg