Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:28-g4   

Cenix:28-g4RNAiCenix:28-g4
PCR_productcenix:28-g4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F02E8.1 Source_evidenceePCR503WS150 Sequence/Annotation Release
Chunk_score Abs_score443
Max_abs_score443F02E8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX44701804471023
Overlaps_transcript F02E8.1.2 Source_evidenceePCR503WS150 Sequence/Annotation Release
F02E8.1.1 Source_evidenceePCR503WS150 Sequence/Annotation Release
WB_DNA_textTH:28-g4844ttctcatgatgccagactcgtggttcaccccattccagaaagttaccggagtctccggaccatacctcttcttcggaggactcttcgccttccttgtcaacaaggagttgtgggtgtttgaagagcaagggcacatgactgtcggatggattctgttctatcttttggtcaccagaactgctggatgtaagtattctgattaaaaattgataattattaaagcacggtggagatagctcatagggatggtcgctagtaatcatgaggtcacaagctgagtttctgcctttttcgcagaccttaattagaaattggagcaatcctagactgaaaaagcgaacacagtccctcgactggttttagttaaagccgagaggtgcgccaagatccgccgtgcttaaaaattgtgaaatgaatctgatccatctgacttctgatccttttttcattttcaagaacaattgaatctactaataactaaatctcttttttttcagacaagatcgaccaaggattgtacaatggataccaagagcgcgtcaacttcttcaagggactcatccaagaagatcttaaggaggctgttgagttcaagaaaacatctgccaagcagaccgagtctttgaactccatcaaggaatcctacccaacagcactcaaggagagcatggcccttcaacttgaggccacatacagaaagaacgtccaatccgtggccaccgaattgaagcgccgtatcgactacctcaaggagaccgaggagagcaaggctcgcgtcgagcgggagcagctcctcaagcttatcaacagcgaagtgagttttggcttgagtggaggaagcaac