Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:30-d4   

Cenix:30-d4RNAiCenix:30-d4
PCR_productcenix:30-d4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS B0348.6b Source_evidenceePCR756WS150 Sequence/Annotation Release
B0348.6c Source_evidenceePCR753WS150 Sequence/Annotation Release
Overlaps_Gene B0348.6 Source_evidenceePCR961WS150 Sequence/Annotation Release
Chunk_score Abs_score772
Max_abs_score772B0348.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV65547693
Overlaps_transcript B0348.6c Source_evidenceePCR757WS150 Sequence/Annotation Release
B0348.6a.1 Source_evidenceePCR961WS150 Sequence/Annotation Release
B0348.6a.2 Source_evidenceePCR803WS150 Sequence/Annotation Release
B0348.6b Source_evidenceePCR760WS150 Sequence/Annotation Release
WB_DNA_textTH:30-d41140atagggggaagcgaaacagtaggtacaaattggaggggaagcaccaatacattaggtggggggtacgacttgaaaaatgagctgattttcgaatagttaaagcgatgatcgtgtccgaaaaacagttcatttttcaagacaacattgagactgggagtacggggaagctcatttacggtgagaggaattggtgagatctttagaatatgcttaaggagttggggtggctggagaagttcctgtagcctccgtgccgggattcgatggagaagtcgttgcggctggtcccttttccttcactggtgctggatccttggctggaagacatatgcgtggcttgacagtcgatgaggtgcgagccgacgagtccttgtgaacttcgtatctggaaatattttacttagatagcaaatactaaaattgtaaaattacctcaaaatctcagtatccggaatgctcaatttctgcttcaaaacctgtccgatgcgaagattgacatcatcgcgagtagcatcacgagtccacaaggaaaccttgtcacccttttgacgaacattcacgacagctccgcagatgtagtctccgtactcgtcgaattgctctccaacaatagccatcaacagctccaaccagtagtgatcgagcaattgcgttcttctctgaagcttctatgattcattgaataaaatatatttctcaaaacgtacttgcttatcgacaacaaccaaccaacgtccaccttgaacgttgttgacgtcctcccacattggcttgattccttccttgaacaagtaataatcggatccccagttcaatcctccggcagactgaatgtgattgtacagcgaccagaagtcctcgacagtgtcgaaaagtgaaaccatctggaaaaaatcgataaaagacgtatttaaaaatcttctaccttcagacaatcctcccattccttgttacggtcagctttcaagtaccagagagcccagcgattctggagggggtgtctggtgagaagctctggaggaactgaagcatcggacgcattcacatcgccggaagctgacaatgctttgttttccgctacggatgtgctcatttagctgaaaataggtaatattatatacgattagagctcggaaaacg