Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:30-d5   

Cenix:30-d5RNAiCenix:30-d5
PCR_productcenix:30-d5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06A5.1 Source_evidenceePCR1115WS150 Sequence/Annotation Release
Overlaps_Gene C06A5.1 Source_evidenceePCR1115WS150 Sequence/Annotation Release
Chunk_score Abs_score1010
Max_abs_score1010C06A5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI60193996021098
Overlaps_transcriptC06A5.1 Source_evidenceePCR1115WS150 Sequence/Annotation Release
WB_DNA_textTH:30-d51700tcttctgcgaacagctctgaaattaaagaaaaacgtcttgtcgatgagtttatgatacaatttgtagaggataaaggagaagtgattgattcggatgatattttaatattcattgcatcgattcaaagtgtttattctggagaaaatgctgaaattactgcagaaagatgtctatcaaatcggtggtctgcacaattacgaaaagtagtgagctcgacaattttggagaaatattacactcagttatgctcgattttcgtgtttcggctgatttcggcatactgtaagaagtatccattggcatcgtacagtgaaatgtttacattacgagaacctggaaataaagaggaatttgtgttaaatcggagagcattcgataattgcattctttatttttgtgatgttgtgagttaaaaattaaccggttttttaatgggaataaaattgaattttcaggcagccgacagtcatgaatacgacctacaaattatcaatttgatcgctggattggtaagttttttcgaaaaaaaaacagtaaatggaaaaaatttcgaaaaaaaatggactgaacaaaaacaaaaataagccgaagaattgatttcacaaattttagggattaaatagggaattcaattcaaattgatgtattatttttaagtgtaaaacaaataatatttttcaggaaagccaaggaggcactgatacgggattctattttggacgtgctcttctggaaacggcgtgtgcaaatccgaaatctgtcactcgaattacggcaaagcggctattggaactactcagagatcggttaccttgtcagttaaaaattacttttaaaatttacagaaaatgtaattttaaacaaattttattaattttgataaggaaaaaaatgtgattattgaaggatttttagaaaaaaacaacattgaaaatcctttttaactgactgcgtcggtttttgaattcaaagttgtcagatacctatatcagaaataaaaagtcacgacgcagttagatgggcaggttattactgtagtgtgataacaaaacaaatcgtaaagtacttaattttttgaaaaatatttttaaaatttcagatctctcgtaccgaaatgggatttcctcatcgattcgtgttctaacaaatgtggaatctcgagaatcttgcattagaagatgtgaacaaattgtggatcgaattgttgaaatgccgattgatttgaaaatggcactatctgaagatatatgcgaggaagaacgtattaaaaaagatagaataagagaaaaaagcgaggaggcggctgaaaattccaaattcggtggaaaacgatcggcaggagacagaagaggaggtggtcctccaccgaaaaaaggacgattcatttcagcgaaagatcttcccgttccacttggacaacaaaatgatgaggatagtataaatgcagaagatgttccagtgaaaagagaatggattgatacatcacatgcaatgacacgattcgtatccctgctcagagagcatcctaactttttgaaaatgtacggggaaagctgggtttagttggcttagaaggctttttctaggtggaaataagttacatttaattcaacctaaatttgtttttaaaaatgaaaaaataacaaatttacaggaaattcccagtgctagccaactacgtatcccgagtgaatgcgat