Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:300-b9   

Cenix:300-b9RNAiCenix:300-b9
PCR_productcenix:300-b9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0393.8 Source_evidenceePCR141WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcript B0393.8 Source_evidenceePCR141WS150 Sequence/Annotation Release
B0393.1.1 Source_evidenceePCR888WS150 Sequence/Annotation Release
B0393.1.2 Source_evidenceePCR836WS150 Sequence/Annotation Release
WB_DNA_textTH:300-b92066gatttcaaaactatgcgaccaaggctgagagagcgacattttcggaaggcacgagtgtagaaaagtcttccgcagagattgagcatttgactttctgaaattatattcataatccagctattcactttttgaacttacgcgatgaccaatatcttgttctgatcgttattgacgattttgtacatattttatgtgacggaattcatcgcgctgacgacatcaacaaatcatttccagactggagcaatatcgagctctgaaaaggaaaatttaaattttttttctttaagccaccgaaaatagctataaaactaaaaatgacgtttgactgcgcagagaattgaaaagtacgatattgaattcaataaatatacatgaaaaagagtaaaaactgcgaaaagatcacgaaaattgaacaagaacgacagaaaaaccaagtttattgcgaaaaactaacattagatatatcctcgtaaatcgacacagcgggtctcgccgcgatttgccgccaacaacgtcaccaactacggtatgtgtggatgtcgagaaatgcggagaaattgcgaatttcacgtcatttctccgcacacttgcattgcaaaaaaattgtcgagaaatgacgagaaattcacttgcatcatcccattactgtaatttttgaaagcttacataagaggaaaatgggattacgattttaatctcgtctattggcacaagtaatattcattaaattctttaaaacgttcgccgtccctgtacatggtcttaataactgttgacttttcttatatataaatttgttcaataacctcataacatagttaacaaggtttatttcaaagaaccaacattgtaacaaattgattaccagttagactgggttggagcgttggcccactcttcggtggtcttggtctcggcagtccaggtagcggtctcagcggcccaatcgtcaacctttcctccttgggtggtgaagtcgatgtcagttggttgttggtattcttgagcctcagcaacatcagcgtgagctccagtctcctccttctcggtctcagttgggtcacggtagaagtaaagatctggcatgatttcctttccttcgaggacgaatccggtttgacgggagatctttccacggagaatgaggatctcgcgagcgagcatccaccacataagtccgattgagcgttctccctacaattcaaatacatatttacattttttataaattaaatatataccttgttgttgcatggaactccgatgtcgatcaacttgagtggagactcggtgttgacgaaggagatgactggaactccgacgtaggaagcctcagtgacagcctaaattttaaataattagaaaaaacaactatttagaaaagtcttacctgatgatcgatacgtgggtcagagatgacgagaagtcttggctccttgaaggtcttttggatctggttggtaagacatcctggagagaaacgtccgaagatggcggtagctccggtatgagcagcgaacttgagaagagcacgctgggcgtatggtctagccgaaacaacgacgacatcagctgggttctcaacagcggcgatagcgcgggcagcgagaagaagcttctcccaggtcttcttgacgttgatgatatttggtcctgtaatgataattgttataattttattaaataattcacaagaaaaatgaattgaattttttttaaactaaccgtcaaaacgtctcttgtagacgtattgctgcatttggaagttaagattggtggatcccaaatgggcctgggtagcaagaagcttcataacatcctcctcagtgagggcggaatgagcggcaccgcctgacatattaccttaaaattcaaaaattaatttcagatcagtcataaccaagaaaacaaaataaacgttaggacagaaaattcaaattaattaaaaattatgctgaataagaaaattacatgcaaagccttattttcctcatagaaacagttgaataacatattttttaattgaaaacatagcaaaattcgtggtaaaatttgtcaaaacc