Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:300-f2   

Cenix:300-f2RNAiCenix:300-f2
PCR_productcenix:300-f2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R107.6 Source_evidenceePCR870WS150 Sequence/Annotation Release
Chunk_score Abs_score828
Max_abs_score828R107.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII90561169057048
Overlaps_transcript R107.6.2 Source_evidenceePCR870WS150 Sequence/Annotation Release
R107.6.1 Source_evidenceePCR870WS150 Sequence/Annotation Release
WB_DNA_textTH:300-f2933ggttctcgtacctcttccaatcttcgtgctcgtggaagtgtcccaacgtctcagcctggttctcgaaatggatcaccgccacgccgtccatccgccacagaggcatttccagccgaaatgcaacgagtcaagtcgaatcttggttctaactcgttcgtttcttctctgtcagccgaggaagctacgaaactgcagaaggcaatgaacacggcaaaggagagcttgaggcaaccatcacgcaacgatgatgatgagttcctcttgccaaaacgtccaaccccacagaaggcaacaccacaaaaaagtgcacttgatacttccagagtggaagaagtgattcgtgcttgttcgtcgacctctgcaaatgagaagcgagaaggaattaaaatgcttgcaggcattgtttcggagccaaatctcagcaacgccgaaatcaaaagcctgggcgcggttcttaacagattgctcggagaatccacgaaccaggtagaacattttaatttaataatttttattgcaacattttatttcagattgtgctggaatcaatcagttcgtttgtcaaaacccatcatccccgtctcagtgattggctcaagcttggccttggaaagctgtttgcaaagaaaggagcagagatgacgttgaacagtaagaagcaaatttccacaaccatcagctgtattctgtcatcgtttgatccaaccctgcaattgaaatcaacatgcgagctggtgtgcgatccaattcatctaatgtccccgaagagtcgcgtggtccttcttgaatatctcaatgaacttcttgggaagtatatggagcgaggatcgtcgttcaacactaaagagatgaaggccaccattctcaagatgttttcgtggatggcagatcagaggaatgaacagttgatcaccccggtaattatagctctct