Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:301-c5   

Cenix:301-c5RNAiCenix:301-c5
PCR_productcenix:301-c5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR144.2a Source_evidenceePCR1471WS150 Sequence/Annotation Release
Overlaps_Gene R144.2 Source_evidenceePCR1471WS150 Sequence/Annotation Release
Chunk_score Abs_score1408
Max_abs_score1408R144.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII50275895029160
Overlaps_transcriptR144.2a Source_evidenceePCR1471WS150 Sequence/Annotation Release
WB_DNA_textTH:301-c51572gccaacatcagtgataggatctcacgcatttgcccctgtagctgctccgatccgtcctatgatacctgtgccaccacctgtttcagtggctccatttgtgcctgctccgccactttcgtctgctcctccattccaacatcctcaacaacatcatccacaacttccacctccaccagttcatcaaggaatgggaagaggatatcatcataattcgcctccacaagatccggcaccaatcgttccagttcaagctccacctccacagcaacaccttccagctccagagaacgtttactcgtcagaacaaccgaaactcgatgttccagccaacaaccgtatctttgtcgatggaaaagcttatgaagtgatgtttgtcgatgatactgcagttatcgagcgtggtggtgctccacatcgtatttatttcgctggaccgccaagaaacctcgtaattgatggaatcccacacttgcttcagtttgacactccaactcaaattgacatattaggatcaaagcatatggtcaagttcggagcaccatcccgcgaactttacattggtggtcacccattcaaaggtaaatacacatattttcacagtttttaattcatattcgaactttcaggtcaatttggaggaccaccgatcattgcaacgatcaatggacgtcgtcatgagatccgattgactggaagtgctccagaagttcgcattgagcctgagccagcatatcatcttactcatttcttgcacaaaatgcgcgaggagaagaagattgaaattgcatcggagaagccggagaagaaggaggattggctctcatatctgaaaaatttgagaactcgtaatatattgccagctccggccagatcgccatcttcgccacgcaaccagactccaccaccagctaatcttccaattccgggaatgaataatgctggacaggtaattaactatcaggattacagtctcttaaataatttattgttttcagagaggaggttatcataaccgtcatcaaccacaacagaacgctagatggggtggagcgaataaacagcagaatataccaccaccaccatctgatccatctccaattggaagtggtgttgagaagcgaagtgctccaccggcggccatcacagatttcaatattcgtctcttgcaaattcgttacgactcggtcgttgacgcgttgattaccaagagagccgacgcttgcaagttttgtggaatgagattagatgattctcaaggaaagtcaaaagaatggcaagatcatatggattggcatgtgaagcaaaatttggcacgccacgggtcgaacaattcggcagctgtaccatatcgtcagtggtatccatcgacatccacttggcttacaccacgtgcatctgatgaaacgaatgagcaagaagctgataaacccgaggaaccacttccaggagtagcatcttccggtgttaaaaccaaagaatgttcagtttgtggtgagaagtttgacgagtattatgatgatgacgaggaaacgtggcgattaagggacacagttaatgttcacggaaaggtga