Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:301-g7   

Cenix:301-g7RNAiCenix:301-g7
PCR_productcenix:301-g7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F48E8.5 Source_evidenceePCR1469WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII54509545452617
Overlaps_transcript F48E8.5.3 Source_evidenceePCR1469WS150 Sequence/Annotation Release
F48E8.5.2 Source_evidenceePCR1469WS150 Sequence/Annotation Release
F48E8.5.1 Source_evidenceePCR1469WS150 Sequence/Annotation Release
F48E8.5.4 Source_evidenceePCR1469WS150 Sequence/Annotation Release
WB_DNA_textTH:301-g71664catgttcattgtcttctccttccacttgagaacttggccacagtcgaggagaccgtggtccgtgacaaagccgttgagagtctccgcaaaatcgccgacaagcacagctcggcctcattggaggagcatttcgtgccgatgctcagacgtttggccactggagactggttcacatcccgtacctcggcttgtgggcttttctctgttgtttatccacgtgtcagtccagctatcaagtcggaattgaagaggtgagaattaagaaaagaataactaaagcaatctaaattaattattttcagcatgttccgaaccctgtgccgtgatgacaccccaatggttcgccgtgctgctgctgcaaagctcggagagttcgcaaaggtgtttgagaagactgccgtcatcgagggtctccactccagtctcactgatcttcatgttgatgagcaagattctgttcgtttgctcactgtcgagtcagccatcgctttcggaactctcctcgataaggctaacaagaagaaactcatcgagccaattctcattgaattgttcgatgacaagtcgtggagagttcgttatatggttgccgagaagcttatcgagattcagaatgtcctcggtgaggatatggataccacacatctcgttaacatgtacacgaaccttctcaaggatccagagggtgaggttagatgtgctgccactcagagacttcaggaattcgctctcaacttgccagaggacaagcgtcagaacattatctgcaactcactgctcaacgttgccaaggaattggttactgatgggaatcagctcgtcaagtcggaactcgccggtgtcatcatgggacttgctccactgattggcaaggaacaaactgtctctgagcttctcccaatctacatgcagttgcttaacgatcaaaccccagaagttcgcctcaatattatttccagtcttgataaggtcaatgaagtgatcggagcagctcaattgtccacatccctcttgccagccatcgttggattggccgaggatggaaaatggagagttcgactcgcaattgttcaattcatgccacttcttgcttcccagttgggacaagaattcttcgatgagaagttgcttccgctttgtttgaactggcttaccgaccatggtaacttgattttttcttaaaaatgtttttaatttaattttttccagtgttctcaatccgcgaggcatcgaccctcatcatgaaggaactgacacagaagtttggaggacaatgggctagcacgaatattgtaccaaaaatgcagaaacttcagaaggacaccaactacctgcagagaatgacatgcttgttctgtttgaatacactcagtgaggcgatgactcaggagcagattctgaaggagattatgccaattgtgaaagatgtagggaaattttacttttttatttaaagaaatcgtaatttttctaatttcagcttgtcgaggatgacgtgccgaatgtcagattcaacgccgcaaagagtttgaagcgaattggaaagaacttgaccccaaggtgacaggaaaatctttttcactatcccaattttctattttcagtacattgacgtccgaggtgaagccactgctcgagaagctcggaaaagattcagactttga