Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:302-a4   

Cenix:302-a4RNAiCenix:302-a4
PCR_productcenix:302-a4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F57B9.6 Source_evidenceePCR1187WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII69302646931641
F57B9.3 Chunk_score (3)
Overlaps_transcript F57B9.6a.1 Source_evidenceePCR1187WS150 Sequence/Annotation Release
F57B9.6b.2 Source_evidenceePCR398WS150 Sequence/Annotation Release
F57B9.6b.1 Source_evidenceePCR1187WS150 Sequence/Annotation Release
F57B9.6a.2 Source_evidenceePCR1187WS150 Sequence/Annotation Release
WB_DNA_textTH:302-a41378gaaaagccatctgctattcaaaagcgcgcaattgttccatgcaccactggaaaggacgtcatcgctcaagcccaatctggaactggaaagactgcaactttctcggtctctattcttcagagaatcgaccacgaggatccacacgtgcaagctctcgttatggccccaaccagagaattggctcaacaggtaaactttctcactcagtgtattttagttatagattattagcagatacttttaaagaaaacttttcaaaatctttctttgtagatccaaaaggtcatgagcgccctcggagagtacctcaacgttaacattcttccatgtatcggtggaaccagtgttcgcgacgatcaacgaaaactcgaagccggaattcacgtcgttgtcggaactccaggacgtgttggagacatgatcaatagaaatgctcttgacacatccagaattaagatgttcgttctcgacgaggccgacgaaatgctttctagaggtttcaaggatcagatctacgaggttttccgttccatgccacaagacgttcaagtagtccttctttcggctactatgccatctgaagttcttgatgtcactaatcgtttcatgcgcaatccaatccgcattcttgtcaagaaggacgagctcacccttgaaggtatcagacagttctacatcaacgttcaaaaggatgtaagtttactcgcccagtctaagaaattgttttcatgaaccattttttcaggagtggaagtttgactgcctctgtgatctctacaacgttgtcaatgttactcaagccgtcatcttctgtaacactcgcaggaaggtcgacacactcaccgagaaaatgactgaaaatcagttcacagtctcttgcctccacggagacatggatcaagctgagcgtgatacaattatgcgagagttccgttcaggatcttcccgtgttctcatcaccacagacatcttggctcgtggtattgacgtacaacaggtaagtataaatatttgtgtttataattcaatactatggaatgtatatattttaggtctcacttgttatcaactatgatctcccatccaatcgtgagaactacatccatcgtatcggacgttctggacgtttcggtcgtaagggagttgccatcaacttcgtcaccgagaacgatgctcgtcagctcaaggaaattgaaagctactacaccactcaaatcgaagagatgccagaatcaatcgctgacctcatctaaattttaatccaattccgatcccctccacgattgttccacacgcttttcccttcctcttgtttcctcatatttatccatgttatctgttttctcctccacccccaccgtcccacatttttatttta