Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:304-a12   

Cenix:304-a12RNAiCenix:304-a12
PCR_productcenix:304-a12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F11H8.4a Source_evidenceePCR2042WS150 Sequence/Annotation Release
F11H8.4b Source_evidenceePCR2042WS150 Sequence/Annotation Release
Overlaps_Gene F11H8.4 Source_evidenceePCR2042WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII70243287026604
Overlaps_transcript F11H8.4b Source_evidenceePCR2042WS150 Sequence/Annotation Release
F11H8.4a Source_evidenceePCR2042WS150 Sequence/Annotation Release
WB_DNA_textTH:304-a122277catcaaggtttgaaggaaatcagcatttcctgtagcacgctccaactcatcgagcacaccagccttatcggcagctgaaaaaattatattaaaaaacaatttcaaaaatatcaactcaccagtcgaaactcgaatcatcgcagccggagttcttggcactctattaatcgcctgtctctcttgtaacggcttcctttcttgttgagattgttgcagctgcttccgcttctgtgtctcaaattctgcttcttttcgttttgcttctgcttcggcatccaactctttccaagcattcgaatattgctcagagaaggtgcgaatatcggcgaaaaattcttccatcggatattttttgtcgttaaatgcataatacttgaccaacgactcccaatcgtttttcatctttccacacattgacgaaactgtggagaactctttgacagctttttcgtggaacggccgcatcttctcgtcgaataaatcacgttctccttgaattttgtacacttttaagcagttctccagttttttaatgttattctctgtcagttgaacagtttttcgaatttcatccgcattcactcgggacgattcaatgcaatgatggaagtcggtgagagcaaatcttaaattttttaaattttgagaaagcaagtaaaggaatctactcaccgtgctcgtcttggatcgattctcttcatttcttcaattaaatgatgtagaagagtatgccgattatcgacatcttttgtatcaaccagtcttgtcagcattctcatgtcgaacgcgtaagcactcgaatagttttttgtcgctccgcccataaagtttccagtcgccaaaacaagtttcaaaaatgttcggaatccttcagatgctcgtacttcttcgcacgcttccatcactgacgacatggctggtttcagttcattcaacacttcagagaatcgcattttgaatagaaccaagtcgagacgaagcggaagaccttgaatttggagcagacgagtgacaaattgttcaccctcgggcatttcctcaaattgagccttgttcaccgctctcagcttgtcaataagctccttctccactggcattgctgatcgaagttgctccaagaatccgacagttaaaaccttttcgttgacttccaaaatcgccagcttgagctctgaatgcgacattttgattgatccttgaagaatgcctgcaagaaaaagatcataaaaaaggatatacttcttcgagtttacccaatttttgaagtaatttatcgtcatgaatgacttgtgctgtcttcactttctttttgctattcaagacaccaccaagagtaccactatttgcagcaggtttcgtggcgaatttggttcgtaaacgatcgaacattcgatcgctggtcagctgttcttcgtttgttccaacccagaacgactctcttggaatatcccgagggttgatagtatgtgctccccatgggaactttctcatgggaccatcaacctttggaaccttcttgggtggaaggtaatcaggtatcacgggagccatcggtgcgaacatgcctggaggaggtggtggtggcggtccgcccttgaaccctcccggtggtggtggaggaggtggaggtggacatcctccaggaggcggcggaggtggtggaggacctccagatattggaggcaatcctcccggtggaggcggcggcgggggtcctccggtgattggaggaagaccaccaggaggaggaggtggaggcggccctcctgtgattggtgggagacctggaggtggtggtggacctccagttattggcggtagagctgaagatccaccagcagatgtggatggagccgacaagttcatcttcgttggcggaggaagaggtatttttggatcatttatctgaaaaataacatgtttcaatcaaaccgcttctaaaaaagtaaatatacatgttttctcagttcttcagcttctttctggaaatcacataatgttttccagtattctccttgcattgcaacagcttcctgtttggccgacgtggcttgtcgaacttttttggccatctcttcgtcttgcattttatctgtaattaaaattatttaatttttcaatatactctcgatcacaaaccaatgatctcggccacaggaacctcaaacacaaacttataatccgcttgtggatcgattggagttcgatgcagaagaatatctgatatggctgtctcgatgagtttcatatacgatcttttcgtcgacatatcctcat