Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:304-c11   

Cenix:304-c11RNAiCenix:304-c11
PCR_productcenix:304-c11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF57B9.10a Source_evidenceePCR1271WS150 Sequence/Annotation Release
Overlaps_Gene F57B9.10 Source_evidenceePCR1397WS150 Sequence/Annotation Release
Chunk_score Abs_score1231
Max_abs_score1231F57B9.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII69591956961467
Overlaps_transcript (3)
WB_DNA_textTH:304-c112273aaattttcaaaaggagaacggaggactgaaccgtgagggaaaatcgaagaaaatttagaaaatgggaaaagtcgagatattgtacaaaaacaaggcagaacaaaaaatgaagattcgaagaaatcatcagttaattttcgaagcattactatagagtgcatcgacaacctctcccattgcatgaattgtatccagagcagtttggtacgcctcatcgggaacagcaatttcaaatacaataagcattccctcgccttgatcaagagatcccgaaagtttttgatcgagaatcatttgggacaacttcttttcgacctgaaagttttataagtttgtgtaaaaattaacaacttttttgcatttatatttaaaaaacaatatttttggttcttacctttgatctatcaattccaatctgttgagcaacatgttcaatttgaacgaatgagtatggctcaataatacggcacagatctttttcaagcattcgttcactcaaagaatggaaatgttttcggacaactggatccatttgaagttcctgtgggaaagaaccgaatgcaacttggaaatccttaagagatctcttttgtgcagctgcggcgatcgccttcatcgcatccaaatcagaaccattgtatttaagagcaagttttgcggacagaagactgttcacctcatctggaaggtcaagcatcacctgaaaaatttaatataggatttaaatataatagtaattatttttgagtattaccttgcacagaagcatatacttaagagcggtgagggcggacactttttcatcaaccgaatcgtatccctcaaatgcttcgtaaaagtatgagaaagctgtcttgaagtccttctcgtcggcagcgtgaagaattcccgattgaagatcgagagctgcttgcatgcgaggattcacatagattgcgttggcagttgtacgagcaccagtgagagaagcacgagcacgaccaatattggaaagattatagtacgctttgctttcctcaagttcgacttccacgagaacgtccttatcgtcgacttttttcagttcacgaatcaaatcggcagctgaaaagtagattatcagttattttcaaatattacagcgaaatatattaccaagtggaagagcctgagtgtatctttgaagatcattatagaggcgaacaagacgagcagtgagtgtttgacggaggaaagtgcgattttgctcggtggcccattgaatacattctttaacgagtccaacctgaaaatagttgggtttatatttgaagcttattattctgctcaccttaatatctccatcttgatcatcaattttaagacatagatcaacaagatctctgacaagttttgcagcctttgcctttcccaatgacaccaaaaatggcctcgtttgttcaatcatatttcggagctcttcagtttgcttattttgagccaaaatatttcccaattccatgatcgaatcttctttcttcttgatatcatcgtccccagatgctggtgattttacttcaatttgggacaaattggaaaattctgaaatatggaaaaggactcaccgagattggtgaggtgacgaatgacgttttggtcgttttgatgtggaagtgaagtcattgtatccataatggttcctccagacatttcaggtgctgaaattaagattttaattgcagtaaaaagtattgaattttatggggttattcaagtaatgtagcaaaatgtattaaaatacatttgtgacgtcacaaatgtatttaaatacatgtttttgtttacttgaatacagctgtgacgtaacttttctacactttttaattttccgacactacttgaataaccccattaaaaatgaaataacggaatggaaattgtcggagcctcagaaatcaataagtgcttgcggaaaacacaccaactgattatatcattttaaaatatgataattatcatttaattgatcaattatcaaaatataaacggataaaacattagaaaactggtaagaaacagagagtaagacaatgacgatgacaattcccgccagcgtatttttcccggtgtggtacggtacacaaatggtgtttgcggacttgaaggtgacgcgaaaatgcacagaacagaaaattcaacaaaatgttgtttaaaatacaaataaagcttatttttttcgggttgattaaaaaaattcgagtttattaaaaatttactttctcgtaacaatatgttcttcgttgtggttaaattgc