Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:304-e5   

Cenix:304-e5RNAiCenix:304-e5
PCR_productcenix:304-e5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST12A2.7 Source_evidenceePCR717WS150 Sequence/Annotation Release
Overlaps_Gene T12A2.7 Source_evidenceePCR831WS150 Sequence/Annotation Release
Chunk_score Abs_score726
Max_abs_score726T12A2.7
Specificity_index0.54
Rel_score1
Map_statusBest_ePCRIII62446646245787
T12A2.8 Source_evidenceePCR723WS150 Sequence/Annotation Release
Chunk_score Abs_score618
Specificity_index0.46
Rel_score0.851
Map_statusTop85_percentile_ePCRIII62446646245787
Overlaps_transcript T12A2.8.1 Source_evidenceePCR723WS150 Sequence/Annotation Release
T12A2.7 Source_evidenceePCR831WS150 Sequence/Annotation Release
WB_DNA_textTH:304-e51124atgcaaaaataataaggggcaataacagggacaagtggagaaagtgaaaagagtatcgatttgaagtgtgtataaaacattttttaaatagagccaaatccaaaatcagttctcctgatcctctttgtcatctaactttgtcggatccaatttgagcgccttgatttgttttctgttatcactgtcgatttgtcgattttccatttccattctgaaaagttgaataagtaattaaaaattagaacaaagtattttgtcttacctataattattggtaaccatgctgacccatgactgttccaattgttttactttttctcctgccttcaactgtgccatttttcgattcgcatgaacttccatgacggcttctttcgtttttcggagttctttctcggcatgtgttagaagatcttccataactttgtttctctgaagataactctcagcagcgtattcatccataagttccagattgatctggcgcatcagaagatgctcattttgagcttttgcattgcgaagaacctgaaaacgaatattatgatgtattttttaattagtagttgcctttattgattcattgaaatttatctactaaccttcgcccaaagttttctatcaactcccttaacagcagatggagcaggaagttcacaacgactcatatccaactttcccatctcttctttctttttcattcgatccatttctttgagcatacactttgtgagaaaagcatcatagtcgggcactggaagatgtgtcaagtaatttttcgttggacggaatgtctgaaaacattaaattttccatatatggcggaattggcagaagtaatgaaccttgcactcatgctccacaagtttcattgcgagctgtcgatccgcctcgttgtactctgtgtcaaggtaaggaagagcatcgacaagaacctgaaaatagtcattttacactgaaactagtagtttaaactacttaaaaacttggataggtggataaaattgattttagaatctcaaaaatatttacctgatcatcctgcaactgactagaaccacttccaccggtaagtgctaacggtttggagctcatcacgtgaacctgaaattgttctgtcgaaa