Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:304-f1   

Cenix:304-f1RNAiCenix:304-f1
PCR_productcenix:304-f1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF01F1.11 Source_evidenceePCR1150WS150 Sequence/Annotation Release
Overlaps_Gene F01F1.11 Source_evidenceePCR1222WS150 Sequence/Annotation Release
Chunk_score Abs_score1096
Max_abs_score1096F01F1.11
Specificity_index0.9
Rel_score1
Map_statusBest_ePCRIII58694075871674
F01F1.15 Source_evidenceePCR164WS150 Sequence/Annotation Release
Chunk_score Abs_score122
Specificity_index0.1
Rel_score0.111
Map_statusBottom50_percentile_ePCRIII58694075871674
Overlaps_transcript F01F1.11 Source_evidenceePCR1222WS150 Sequence/Annotation Release
F01F1.15.2 Source_evidenceePCR72WS150 Sequence/Annotation Release
F01F1.15.1 Source_evidenceePCR164WS150 Sequence/Annotation Release
WB_DNA_textTH:304-f12268taatgaagaaaccgatgcagattgaatacccgacagtgatatgagacaaaccagtgtagaaacaaaatgcattctgaataaatggttaaaaagcgtcgataatgaccaagtgaagcggagagagagagagagcaaacaatgattgggagagtggcagaaagaaaagaaaaagaacggtgtttggataggtatccagtgtttgtgtaaatggtacttttcttcacgaataaaacatgaatattattcattaaagttgattggaaacaacgtattcaagagatcgaaaattgataagttaaacattttttcaattgggaaccggtcgacgtacacgtggaataatgtcgcagagccgttgtctggaaatttaattttaatactattcagatatgaactctgaaatctcgtctcaaagatatgttacccggcctcgtcacgtacaattttttcaaaagtagtactgtagtgaaaaactaaagaacgctccgcaacagcgagcagcaatgaaattttatttttggtatttttcgaaaaaaagggagcgaaaatagagaaaaattctgttatcctgtcggtaactgaaaatataattgattttcaaattttacgctttttccaaaaaaaaattacacttataactgaatgcaaattttaaggattttaaaatcgaaattattttttaaacttactcaaactgcgttcgcttcttcatattcgcttcggaaggcagatcgtgttctcttttcaaaaatccttcataatctttccatgtaacacaagaagttccttgttctcgaccacgcaacgggctcaacagaatgcccgtgttcaggcaaaacggcatctctcggagctcatttctgaaatttaattcaatgtattttcaaggattcaggcacttacaagcaatctgtaattgcatctcgaaagaatctcgtcaatggatccttcaatcgacaagcttcttcatatcgttgaacacgcattgattcatcttctccaagtgaaattgatagtggtgtcattggatcgagctgatcgtatgggatgtttgcatcgctaattcctgtcaaatcgagcagaaactctggaaaaaacaataaaaattgattattggcaagggtatcattgaaattttttatggattttttttctgagaaaatcaaaaaaaaagtttagcaattttacaacaaaaaaatgttttgtttaaatcaaattaggcttatactgttatcaatcaatattattaaggaaaaacatataattgccatctaaaaaggaaaaaaggtcaacatttaaaactattttttgaaaaaacgaaaattgtttccaaatattggaaaaagcccatggattctctttttttatttaaaacttacgagtaatagttgaaacaatggcggatggtaagttaagaatggctcttctttgactatttccagctcttcttaaagtatatctccagatcatgcatctcggacggcacgcaacacaaaaatatgcttttataaactgcttggttttgttgagaagttttgcgtttctgcggaacgtcagcaaactgaacacatattgaagatcggcattctaaaatttggcattttttcatagaagctgaaacaaaaaaaaactcacagagaatacacctgttgctcgaatattgtaagaagtttgttggcaatgcgagagattcattagacttaaatcgattttatcgaattttgactctgaatttgtgttggtcgtctgtcctacaattgttcctctcaggtctttaatgtttgactttagcgcatttagctgaaaaatcaaaaaatggaattttgaattccgggctatcagaattctgaccataatagacgttccaagcattgcaaaccttccatcagccgccgatggattcaccataccttctaccagcgattccatagaaatatctccgagaaatgtggcttcagatattccgcaacggatggttctctccaatgaagcttcattgagcgttttatccgatgtcgacaccatcacacgtgttccaagctcgattatatcgattttctctgaggcaatgttttgctcaattttttctgaaacaataattgaacttttaatattttattgataatttttttacccattcgatggatttttttcattctttgagtcgtcttaaaatctttaatatcttcttttgcatcattataagaatcatatttttctccgcccatatagtcctctacatcgactacgtcttccatttccatcatc